Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932031
Length 704 bp
Fasta Format > whchan10a16
tgatattacaagtccagcctccatcggaagccatgggcgaatccacaaga agaaagtttcaccaccggagcttttaagattacaacacatttttgcactg tccacctactcctccacactttgtacatcctcagcaccccaaaataacaa ttcagaccacctgaagcctccccggtcggtgaaatcgacggatttattgg ccggagatggtctggatgatggtgttgtgccatgggtcggccaggtgctg ctgcaggttctcgaacgggcccttgccggtcacgttgtgctgcaccagga accccaggaacgccagcatcgccaatctcccgttggcgagctccttctcc ttgttctcgagggtgggggcgaagttgagggggttgaagacgctgccggg atagccgcactcgtggggcgggaggctgtagctcttgaagatggggtcct ggttgacggagcccgggttcttgatgtcctgccaccgccggatctccacg tagtggaagaggatgaactcgatgacgaagagcgtggaggaggaggcgaa gtaggtctccttgccggcgtcgtaccactcgggcgcgttcagcagccccg ccttggtcagcacctccgggatcancatccccgccacccccagcatcgcc caccgcccgttcaccagctccgcctgcacgaaccaccgcaggtcctcggg tcct
Download
page-top