Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932030
Length 561 bp
Fasta Format > whchan10a15
taagctcgaatacacaagagtcagcggaagtaacaatatctgagtacaga cataagttagacaagtttgccttaaaaaggctagcacaaaagcaacaacg gtcgaaaaggcaaggcctcttgcctgggagcctcctaactactcctggtc gtcggcggcctccacgtagtagtaggcatcctcagggtagtagtagtcat cagtggcgtcgtctggctcctgggatccgtcatctggttactcagacaag gaggggtcgtcggtgacgtagtcgatcacagcggcatcatcggtctcggg gtagtgagcacgaaggcgaggtcggggaggccggaggtggaccggagcgg cggcaatcgacgccggacgccggcgatgtacgcgttgaagacgaggtcga tggcgagtgtacgggccttccttgctcgattcagtgctcggggtagacga agtagacaacgacggttctcctggacctcttggcgcgacgaggggaggcc ggtggccgcgggatcgacgagaggcggcgacggcgtctcgggcgcgtgtt gtggagaggag
Download
page-top