Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932028
Length 362 bp
Fasta Format > whchan10a12
acggccacacagtgcctgatcgaagataaagtttactacagctttgatat ggatggggaaatagttcagcgtcttctgagtgttgcctccctccagctct ttcctcagctgcagtgagaaatcatcgttcacgtcgtcatcatcccagtc atcctcccattgctggacagcttcgttgccatcttccttgtcatcccatt cttggtcgatctcgaactcctcgaactcgtcgtcgtcctcgaggaggtcc atcttggcggcctccgccttcgcgtccgccggcgctgccgccgccatcga tgctggtgctagtatctagctgattcgcgtggagaagaagaaagggggaa ccctagacctgg
Download
page-top