Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932027
Length 755 bp
Fasta Format > whchan10a11
gcagaacatacatagttacatacaaaaaccagtccaaaattcatgacgat tgctacgaaataacgctagggcagaagttctctagcacatcacgtccaac gggaggtacatggtgataacaacacacatgatttatgatttatttatgta cagccatcctatttacataacagagatgctactgcagagtctggagtctc ccgcgggcgtttcaggaggcctcggcggtggagaaatgcattttagtagc tgtctcaagcaggaagctgcttccacatttggcctcttggctgctgatgc catagtccaacatctcggtctcaagcttgccggggtcggctggagcctcc ctaccaatggaggtgccaaggtcttccagttcaggagtctggagcacagc ttgattttgggcagcgttgctggtttttttcttgttcctggccttccgct tctctttctgtttggtcttgtccttcttacggggcttgggccgtcgccgg taactgttgttcacagaatgagaaacggatgaaacaggggggtcatacac gtcggccgcccatttgatgtggcgatcctctgctggtaaaggaatcccat tcttttggcggcttcctttgctttccccgagcatgaaacagtcgactcag aactggtacggacaaggggaatccgactgtttaattaaaacaaagcattg cgatggtcctcgcggatgctgacgcaatgtgatttctgcccagtgctctg aatgt
Download
page-top