Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932024
Length 499 bp
Fasta Format > whchan10a07
ggagcagttttattgattacacgttgtaactaattaagttcacacccaaa gttccaaacaaaaatttaagtgcacacccacatgagagcagggccatact caagttttattatcaagtacccgatcgagcgcatattattgcgaatatat atagttgactttggccgtacgtggaagaattagctagcttgcatgcatca aggctgccctccattgtccgggtgagggggaggtgcaccgacaccgcgtg gcggcggtgggcatcgaaatagtccgcggccacatggaatcggaatgtgg ggacggggaatgataccacgcggtgtgcttgggattgacccgggtcgacc gctgatctccctgtgaactccgtggcagcccgtgatagcagcggagaaga cgaccagcaacgcgaccaccaggagacgggcagccctggccagcgacgcc atcttgtggtcagttgtgactacttagccatctcgaggcttaatttgag
Download
page-top