Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932022
Length 759 bp
Fasta Format > whchan10a05
agacaacaagatacactcccaacatcaaccaccctcactttggggcgttc ctgatgcatcacaacagtatcccccgtctttcggggtttccccgctggcg gcgggcatactgcactacaaatacataaatatgaagaagaacatacacat caccgagattacggacagacggcaccgacacagacaggctcacatcttta gaggcctacttcttccgagtaccaggtcctttctgggggaaatgcaacca ccaaccaacagcttgcgctttcatggacgacggacgggacagatcattgt gaaaacatcttccacaacttacagggatgatatttactaaaaagaaccac agagcaaccacaaacatgttccgaagcagatcaggcgtcttctgtcttgc acaggtctagcagtgacagtgtctctgctatggagagctcgaggcggaat ttaggaccatcatagtggtgcagcactggcctgaaagcatcctcttccaa ggccttgcaaagccttctaatgcggatcctcacctgtgctgggaatctgg attcacctttgcacttcttatcttcccaagcagtgggatcaatgtttgat cctccaaaactagcagcctcaaacaccccatgtagctgatgggtcgtgta gttgtagaggaaaagaggtagaccaggagtgatggctcggactgaatcac gatatcttgctggcaagccaaaaagctgtctcttgagatcctcctgcatg gtatcattg
Download
page-top