Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ932020
Length 680 bp
Fasta Format > whchan10a03
gcatatacatagccaccgaatagcattcacatacgagcatgctttctcga gccatgttcgtacatgaacatggacatacacatattcttaggaacaaata agaaagataaatggagaaggaaaacccaaagcaatgtcagagttgacaaa actgcaatggcactttatatatggcctgtcgtgagtgagctgtttaggcc ttgccggactcctcgcagcccggtggcttgaaggcgatgaagctgacgca ctgcacctgacgcatgttgtcgaatccgatgatgcggacataggcgtcag ggtactccttcttgacctcctccacctcgttgatcacctgcgtggcgtcg gtgcatccgaacataggcagcttccacattgtccagtaccggccatcgta gtacccaggggatgcgttgtgctcacggaagatgaacccaaccttgctga actcgaggcaaggcacccacttggagcggatcaggtagtcgacctgctta aggagggcctccgtgctgagcggtggcaagtaggacagggtctcgaactt cttgatgccctcgatgggccacacctgcatgcacctgatccttccaccgt tgctgacgctgccgaggctagcgccgttggagcggcggctgacggggagg ccggcggtggacttgagcccctggaaagga
Download
page-top