Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ244913
Length 556 bp
Fasta Format > whf17b22
ggggagaggatgttgtccatcccttaaagcttctctagaagatctttaca atggtacctcgaagaagctctctctttcccgtagtgtcctctgctccaag tgcaagggcaagggatccaagtctggtgcttccatgaggtgcccaggttg ccaggggtcaggcatgaaagtcactattcgtcagctggggccttccatga tacagcagatgcagcaggcctgcaatgattgcaagggcaccggggagagt attaacgacaaggatcgctgcccaggctgcaagggtgagaaggttcttca ggagaagaaagttctggaggttcacgttgagaaggggatgcaacacaacc agaagatcaccttccctggtgaagctgatgaggcgcctgacactgttact ggagacattgtatttgtcgtccagcagaaggaacacccgaagttcaagag aaagggcgatgatctcttctatgagcataccatatctctcactgaagctc tttgtgggttccaactcgtcctgacccatctggacaacaggcagctgctc attaaa
Download
page-top