Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908397
Length 534 bp
Fasta Format > whthkles10f17
ttactttgcatcgttgatgacatacattcacaggaggtagctacgtagat tacagagacgtgcatgcaagcagagacccggccctgtgttacacgtagat gctctcttagccggcgagagcgctggtgttgtagacgaggaggacgccgc cgccgaggaggccggcgagggtgacggcccagataagaagcccggtcgtt ccgccggcgtagcggtcaccagattcagaccattcctccggcgtgtagat tgggctgtagccgtcgacgttggcgccgtacttgtcaacaaactggtaca cgcccttcttgccgaccttcctgccgttggcgtcgatgtcgactgtcaag ccgcctccgagtccgaggggcttgtcgaccttgatcttcttgccaccgct gcagacgacggcgaaggaggagccccggcgggagagggacggcaggctcg tcggcgccacaatcggcgaggtgatcatggaggctgccatctcgcgcgcg ctctctcaagctctgtctgtctgcgcttgcttgc
Download
page-top