Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908394
Length 657 bp
Fasta Format > whthkles10f14
tcagagaatacaggatccgtcaaaaacgtctggcgacgccaatacaagct cagagcatgaacctcgaccagcagctcatcgtactgaagaacaacagggc cacgccagctgcggaaagcctactgcattccttccagctaataaataaaa ctggcatggctgatttttagacgagggcgctgatttatacagttttttcc ttcttatgctgcaacaacaaaaccagaatctatcggatgagagcatgcca tgtacagcggggtagatgttcgccctggattcctatgtcggcacgacgac gtcgggaagtgcggctgccggtccatcgtcatcgggaacctcggcgttct tggcaggctctgcggtcttgccctcttcatcctggaacccctgcttgaag aggtcgtagtttgttagctcggctgccttgaagggtcggtctcctaatac cctggtcagatcgtcctggtggaggacctccttctcgagcagcaactccg cgatcagagctacttgttccttcttctccgtcaacagttcaacggttctt ttgtaggccttggcgacccattccctcacctcagtatcgatgatggatgc tgtttggttgctgtaaggcttgttcatttcaaagccatcctcccgctgag ggaagga
Download
page-top