Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908393
Length 709 bp
Fasta Format > whthkles10f11
catcagnttcctttgggaaaattccagtcctggttaatcggtagtataac ctaaacacacactgctccggtgaaaacccagctcacagatgagggctatg ggttttgaacggcaggacgcaagagtaagtgacatactttacactgtcaa caaggactacaacaaatatacgcgacaatgacttcgaagagatccttcca tcagcgtccactctcgggtcagccaggacagagaccaccactgatgaagc cggtttgtttccagcaaagctctcgttcttggggtgcgctttgaggtgat cggtgtggttggacgttgaaccttttaggggaacggccatggaatgtaaa atccttctgttcttgaccttatcggactgactggaggtgaggttctccgt ggagttatgtgatgcgttgtgcataccactggagtagacaggaacaatgg tggtcggcgatatatcaaactggaacacttcggtgcacattccggagctc aacataggacctgacattgcttcactaaaccattgtggcagtaattcatc atcgtctctgtatatgcttccatctccaggaggtaaagccatcagtttat tttttattgctttagcagattccatgacttctccagaattcaactgagca acatggccaggaattgccaanctagtatcttcttgtcctnggttacatga agtcttccc
Download
page-top