Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908390
Length 665 bp
Fasta Format > whthkles10f06
catcacattgacaccaagtggggggcttccatcggcccaaatagcaacac attattctgcaaagttgttactactacttcactactgcaaaggccacggc cataaacaagctggatactactgactgctgcactccataggccgtggcct agtgcccatatgaattcgtggtggtgccgtttgtcaggcgctcgaatttg gcgttgcccgacagtatttcctccacggctttctcgatgcaggtcaaagt atactggacgtcgctgtctgaaatttggtagtgggtgacaagtctgacgc tcttggagcttgctggcattgcaagcacattgcgctgttccaggacttga cacagtttgtcaggcgttatgtgtggatccgcaatatcaaagaataccat attggtctccactgaagttagatcgactgtaaactgtttgattttcttca gtccatctgctaaaactttagccttcgtatggtcatcggcaagcttgcct accgtgtcgcgaaccgcaacataggcagcagcacagagaattccaacctg cctcattccaccacctagtgtcttcctaagaatcttagccttgtatatga agtccttcgaaccaacaataactgatccancaggagcacctaaacctttc gataggcataccgaa
Download
page-top