Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908387
Length 676 bp
Fasta Format > whthkles10f02
tcgagactcaggaagaaagagcagtatgaggaactacacaacaaagaata tgaaaagtgaaagtgacagagcgactaacagagcaaactgcacatcactc agcagtttcagcgactcaaaatggaaaggataaatatatgaaatgacatt aagaaacttagcactgactaccatacaacaagaccagtgtagagcgtcgc ttcaatgtctaatgcttcttcccacttcccaggagcaacatgatcccgtc ttgacgaacttgagaggcggcagaccaagagaatgccatgctcttaggca gatgccttgtcgaacttgaggggcttcaccacctcccaggtgaagtcggc atcatcacggccaaagtgaccgtaagcagcggtcttgatgaacctgtttc cacctttcttcaagtccaggttgatgctgatcatcccgggcctgaagtca aagttctccttcacgagcttgaggatctccctgtcggggatcttgccggt gccgtaggagtcgacgaacacagacaaaggctcaggcacaccgatggcgt atgagatctgcacaatgcagcggcgtgcgaggccgctggcgatgatgctc ttggcggcctgcctggcaatgtaggcgccactgcggtcgaccttggttgg gtccttgccagagaaggcacngccgc
Download
page-top