Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908385
Length 514 bp
Fasta Format > whthkles10e24
ggtcaaacaggcgagatgattccgcatcaacacgtacttagattgacatc ttctaacagaacagaaacattcttcgacatagctcgcagaggaagcaggt tacgctgtagggacttgcactgcacgagcttccaaagcagggaacaataa agctcagcgcccccggccccgaccacgcccacggccgcgtccgcgacccc gacccataggcttccctgtagttggcttcttagacttgaccctgggggta tcctcaaccagcaacgtttccaggtttaagctatcagggaggatgtagta ccgaatgttgtttcctctcacactgatgtgatcaagggttacaggattct tccctttcattgtgagctttacggtcttcagatgagtattcatgcttatg tcaacaccggtgatggtgccgtggacggtagtgccgttcttgagctcgat ggtgaccgtctcgttgttcagcttcatcaagaacctgacgagcttcatct tggcggcggccggg
Download
page-top