Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908375
Length 669 bp
Fasta Format > whthkles10e08
tgtcaccgcacaccaaccaaagcgcatttcttttttcatacagatatgta tgtaacacacaaatgcagtggatggtgctctaagcaagtaggtgttcttc cattacatggacagacaaaggagccatcgaaaacgttccagagaacttga gtttattctgttccggcgatcttcttcttcaagctctcgatgtcggtggc caactctttcctgctttccttgaagaggaggtagcggtagacgaaccacc cggtgtagccgagcccaaccagctccaggagcttggggagcaacggcacg gagttgatggcgccgacgacgacggtggtgagccagagagccacgacggc gccgccgctgtagaggaggaaggtgggcttgtcctcaatcgcctcccact tccccttgaggtcctcgatgatctcgtcgccgctcgccgacgtgtcgtcg gaggcggccttcacgcggagcagggacggcctgggcgcatcttggaggcg gagagggtggaagttgcgccgcgggaggagggcggaggagcggggggcgg cgttgccggtggcggcggggnangcgtgcccctccgaggagggccacgga gtacgccgtggcagccattgatctgtcagtgccttatcgctanagctatc gcttcctcggcctctcgct
Download
page-top