Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908369
Length 609 bp
Fasta Format > whthkles10d23
aatccgttgcggcaccacataatctgagacaggttaagacgatagaaata gccgtagcaaattcaaccacacaaaggatgatccaactaatacatggcag agtggatgcccgtctttcttgctacacatgaaatgattcactgaatgttt cttggctggctatgaaacaaaataacagtttatggtgcattgacagctac agtctcatagctcagtcgcgctcgctaatggctgttaggtgctgatcaat ctcctctgtcgtgagcgaccggaagacacggtcttctttcctcacaacac cgacctcgatctcggtagccttgaaatcttcctgcagaacagattgcaat gcagaaactgcaatctgaacagtttcgtcatatgtgaactgcgggctatc cttcattttcttctccagaaaatttattgcttcctgctccttcagtccgg cactagttgccttgtgtccaaagaagtgacctgcggggtcacacttgaag agctgagcatttttctcttcatcataacccaagaccatggcaactacacc aaggggtctcatgtacgcatgctgcgtgnatatttgtgctttgnncngct atccatttt
Download
page-top