Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908365
Length 602 bp
Fasta Format > whthkles10d16
aattgaactggaaagggcggctggtgactcatatagtttgtgccatgcag gcaaaagaagatctcgaattgccagagctgtgcatctaaagttgttatga attccgtcatcattccattcacagaataccgctaacctcccagttgtcgt tgtcctcgtcgcggcgggttctcacancctctgagtctccctcatcttcg gggaacctacgatcatccatcatacgcctgcggcggttgcggcggccggc ctcgcgggccttgcggatcttcttgtccttggtgttctcgtgccgccggc ggcgcttgatctcctggagcaggccggccttcatcacctcccgccggaag cgccggaagatggagtcctccccctcgttctcgtccaccacgatctgcac gttgtagcccttggcggccagcacgggcgtcggcgcgcggcgggcggtca tgtggaccgccgaaggcgcggagctcttccccgagaacggagccagggga agctggagcagggcccttagcatggaagtgccggtaggggcggccatggc tgtggccttcgactagtcggctctgacggttgctgcgctctctttgagtt gt
Download
page-top