Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908359
Length 227 bp
Fasta Format > whthkles10d09
tcagatttcacaacagtactgtatgcacaaaaaaacaaaggtaaacaagc tgaaggactgattgcagcgactggatcagagctcgtggtaagcgaaaaca agtgaaataaacagagatggcgtcaacccttcaggatgaacgcggcagtt cctccagcttcacggtaggcgccttgggatggttggcaagctggctctcc aagttgctcttgatcgcctcatcattg
Download
page-top