Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908345
Length 376 bp
Fasta Format > whthkles10c18
aatctcatattgctctcatttttctgtctgtacaaaaaaagcacctgcag aagcagaaccagcctgcctgcctacctgcatgatctgtaaaacgaaaatg ttgccaaactcttgatctccttggcacacttgtacaanattcaaggtcta aaactcaaccntgtttgcatcatcaggtgttagttagtaggttanaatgt cacttatagtatcccctcccttcccttctcttctcctcttctttctaggg taaactactgccgaccactggttantggaatgtcatatctattatgctct aattttttttgtaaatttcttcatgggattcttgtggcgcgttancaggc aaaggaacatagtcttctccaggatg
Download
page-top