Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908332
Length 613 bp
Fasta Format > whthkles10c04
ggtctcttcatttcgagtggtcgaagacgagcaaaagagggaggacaaca tggcaggtttggaacggtacatgaaaggaattaagatgcaacaaatgaag cttagcctcatacggtcaccgacctcgtcatgacaccttcatcaagtgca acgactccaggaagctcctttccttccaacaactccaagctggcgccacc accagttgagatgtggctcataacatcagccactcccaccttctcaacag ccgcaacggagtctccgcctccaatgatagttgtcacaccctttttgcta agctcggccaacttctttgcaatagactcagttcctactgcaaacttgtc aaattcaaagacacccattggtccgttccaaatgattgtctgtgttgtgt ccagggcatcattaaatgttttgactgaatctgggccaatgtccagcccc atccaaccatcaggaattgcagatgcagggacggtctgactgttagcatc aggagcaaacttatcagcaatgataacgtcagatggcaacagaagggaga caccctttgcctttgcctttgcaaggagagatgttgccagctcaagttta tcttcctcaacca
Download
page-top