Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908330
Length 765 bp
Fasta Format > whthkles10c02
ttcatccaaatctgctgcggtcagaaagttcacggacacaaccaaacata agtacataacactagaccacagcacggtagcaacaaagcacaagaccaga cgaggacacactgacaatccgatcggaggacacagaaaggcaaccgactt gtgagcccacagacataagcagctccatggccaggcacttactggccacc acggagacggagcaccaggtggagggtggactccttctggatgttgtagt cagcgagggtgcggccgtcctcgagctgcttaccagcaaagatgaggcgc tgctggtccggtgggatgccctccttgtcctggatcttcgccttcacatt gtcaatggtgtcngatgactcgacctcgagcgtgatggtccttgccggtn agggtcttaacgaagatctgcataccacccctgagacggagcaccaggtg gagggtggactccttctggatgttgtagtcagcgagggtgcggccgtcct caagctgcttgccggcaaagatgangcgctgctgntccggggggatgccc tccttgtcctggatcttcnccttcacgttgtcaatggtgtcngatgactc gacctcnaaggtgatgtccttgcnngtaanggtcttgacgaaaatctgca taccacccctgaggcggancaccaggtggagggtggactcntnctggatg ttgtantcancanggtgcgaccgtcctcaanttcttgccgcnaaaataag cnctnntgtccgggg
Download
page-top