Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908328
Length 640 bp
Fasta Format > whthkles10b22
ccacacacacgagaatttacacatgggagcgtacacaaagtacacacatt acacacccattcactcgctagcatgcagtgagcagaccgggataagaaaa gaaagttacaagcactagtagacagtagtacgaagctcaagacaaaccac atgcagcctcggacggcaacgtacgctatgcaggattagataaccaaaag agcagcaaacatggcggcgtcgcagaagttgttgagcaccctctcttctt cttcggccgacggctcttatttagcggtggttgctcctggtcctggtctc gtcgctgtaaagccagtcgtagacggtgggggagttgggctgcgggcggt cgaagaggttggcgccgaggcttttggtggccaggttgctcccggggtgg aaaacgctccgccacacgctgccgccgcgcgggggcgtcgacgacgacgg cgtcaccggcgtggtcggggtcgtcggcatcgacggcgactgcttaatcg cctcccctgcagctgtgttgatggcgagaggttgggtggcggccgccctg cggagcttgtcgaggcccgtctccgggcgaggcccggccaccacgtcgtc ccacagcttgtccagcatcttgcgcanaagttggatctga
Download
page-top