Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908327
Length 619 bp
Fasta Format > whthkles10b21
caaaagcacccaaaagagaaccacgagaggtgcagataaataattggtac ctacacaacctctagttgcataagcggaagtcacaaatacaagaacaaag atcaaaccaggggaaatatcacattaatttactggcagagattggtctag atattacaacggggatactttgcaagtgcctacttctgcgagtcggagga ttcctcctctttttttgtctgcgagtcagagggttcctcctcaagtgcct tctggatgtctttctcgaatgaaaatggtgtggtagcagttgcgtatctg ttgattacttttccattcttgtcaacaagaaacttggtaaagttccactt gattcttgaaccaaacaaaccaggtttgttagctttcagaaacttgtaaa gcggcgcagcatctgggccatttacacgcaccttctgaaaaactggatat tcagctttgaatcttgtgcatgcaaagtcttggatctgctggtcactgcc tggctcttgtcgcaagaactggttgcaggggaatgctaatatctcaaagt ctttctccctgtacttctgataaagctccgtcagctgcgtgtaatnagtc tccgtgaacccgcatttgg
Download
page-top