Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908326
Length 667 bp
Fasta Format > whthkles10b20
gcagcagattgtacaacaatgccaacagtacattttgttcatgtgtgagc cccctctaccatctattacacccatcatactacataggatacatctgtct tcagcttcatcaatataacatctgatacaattgcgcgccgcatcttacaa acaacatagttttcttttgctccaggagaccatgatacaaagtaccggat caggtcctccagctccagcttctatcctatgatccctgaactgcagcaga ttgcttggcttcaagggacttctcgtaatcttcaatggacttgaacagct cggagaagttgcctttgccgaacccgccgcagccacccttctggtactct tcccctctctcgtccttctccatgcacccgatcctttggatcatctccag gaacagcgttggcctgtcccccactggctttgtgaagatttgtagcaaca ccccttggtcgtccctgtcgacgagcacccccagctcctggcattccttg atctgcgcctccgagagcacatccccggcgatgcgccgcacgccttcgta gtacttcggcagcgggggtggcaggaagtcgaagccgcccatggcggagc gcgcacgcatctccctgagcgtcctgagcacgtcgctgctggccaccgcg atgtgctgcacacccgg
Download
page-top