Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908320
Length 652 bp
Fasta Format > whthkles10b11
ttgtgcttaattaatttacattgcgcgcagctagcgagaggacctctcgc tcgctcgatcatggtacaaataaacacacaaagtacgtgcagctacacgt tgatccacgacgtacaagtacacatgcatatctcgtccgatggacggacg gacggacggacggctaaacacatttagcttccgggggcgaagttggtggc gaaggcccaggcgttgttgttgaccgggtcggcgacgtggtcgaagaggt tctcaactggccccttcccggtgacgatggcctgcacgaagaagccgaac atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctc ggcggcggtgtcggggtcgtcggcgaggccaagtgggtcgaaggcgccgc ccgggtagatgatgtcgaggccctcgccgaggggcccgccaccaacacgg tagccctcgatgaagcccatgagcaccacctgcaccgcccagatggcgag gatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgc cctcggagaagatctgggcgccggccttgaaccacacggcctcgccgaac ttgatgccgttcttggacaggatctccggnaacacgcacccgagggcgcc ga
Download
page-top