Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908319
Length 654 bp
Fasta Format > whthkles10b10
gagtacatgaccagtataaaacttaaaagtgcaatcagacattgtccatg tagaaacaaacggcaaaaaagatggcaacgagttatctctaagagtatca ggtgaaagcaagtcatggcattggcgctagaaacacgaatcacggtccga aatcgacacgggagatgtggcgcagactcccctcctactgcatggcctcc tctatcgcctgctcctcctgcggcggctcctctgaggccttggtccacag cgactcccactgcccgtctgacgactccttccacagagttatgtcgccct cgccggcagccacggacaggatgtttcccgtcagggaccaggacaccctc cacaccggagcctcgaagtcacgcatgagctttccttcccacttgcctcc tcctttgccactggtccagatgacaaccttgccgtcttgggacgcgctgg cgatggtggactttgccaggcccaggaccggtgcccatgagacatctctc acgcactctttgtgcatgtcggagaccagagcgctctccagcttccagcc accattgacaaactcccacaccttgacgacacagtcaaagccaccagaca cgatcttgtggacgagctgatctgagccaaccatggacccgagtgctgct gctg
Download
page-top