Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908317
Length 414 bp
Fasta Format > whthkles10b05
ctcgcatgatcttcaaccctttcacttacagtgcgagtaaatgtaccatg tgcgtgtaatcaactcttgtatatacacgcaagttgtcctcaaccgccct tcatctacacaatgtgcatctgaactgtacagtttcatatatataccaac tgatcaaccacagctttaaccttgtacgatgacctccttcaataatagac taacaacgctgctacacacacgataggatctggacgatttctgcacgatg cagcagatcatgccatccatgcgtagtggacaactgggtatgacctttcg atcctccatcgtccatagttcgtccacaccaagtcgtccgcatagtagtt ccgatagactaatacaggaaggaattcagggccgtcaccaccttctctgg ccagtcctcttgcg
Download
page-top