Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908316
Length 416 bp
Fasta Format > whthkles10b03
tatgcggtccggtgcatatacatagccaccgatagcattcacatacgagc atgctttctcgagccatgttcgtacatgaacatggacatacacatattct taggaacaaataagaaagataaatggagaaggaaaacccaaagcaatgtc agagttgacaaaactgcaatggcactttatatatggcctgtcgtgagtga gctgtttaggccttgccggactcctcgcagcccggtggcttgaaggcgat gaagctgacgcactgcacctgacgcatgttgtcgaatccgatgatgcgga cataggcgtcagggtactccttcttgacctcctccacctcgttgatcacc tgcgtggcgtcggtgcatccgaacataggcagcttccacattgtccagta ccggccatcgtagtac
Download
page-top