Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908306
Length 610 bp
Fasta Format > whthkles10a12
acgtatttcaactcacagtttttgacataataaatacataaccacagcaa accaggggggagcaaagggaaaactgaaacctctcgtgcacagctcatca cagaaagaaaacaaagcacaacatcaatccatgtttcagcagatgaaagc cacatgaacatgctcatcactgcagtagaggccaggctgctgagtgtatc cttgcttggacagtgccgcgcgtgctttcataacgagatccttgtttgtt atcttcccatcatcgctcgcaagaatggcctggattgcattgctcatcgc gccaaaggacgtaccccccggtatggttgcatctgctgatgtctggctgg tttggcacccactgatgaggatgccgttgttaggcgcccatgacttagtc ccggcatacgcctcttcagcactgcccatatcttgttctatcgctggctt gaaagtctcttcctcgttgccttcaagcttagccttcaggaactggtgag ctagcgaaccaaccatgcccatgacaccgccctgctcacctgatccacct tcatggaacttatcaagcatgactttcatgaacttcttgatctttgggct ggcatcgtcc
Download
page-top