Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ908298
Length 560 bp
Fasta Format > whthkles10a01
cgacttatcactagtatctaccggctcgaacncgaatttggtcgccttcc atacttcacaagctgcggctagttcaggactccatttgcangctgctcgg ataatttcattaccttcncgaggnagatcgcgcccttcggtacgagcttg tacacnngcttctagagccnctcgattagctgcngcaccaggngcatttc cccaaggatgtcctaaagttcctccaccaaattgtantacngaatcgtcc ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctga agctaccggtatancacctggcatggatacncagtcctgagtgaaangga taccgcgagnangatctttttcaatanaatcatcgcgcantanatcanca nnacctaangtcatttcgcgttccccttctaacttaccnactactgtacc ggagtggatatgatctcccccagacatacgcaatgctttagctantacac ggaaatgcataccatgattttnctgtctatcngtaactgcgtgcattgca cggtganggt
Download
page-top