Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208669
Length 452 bp
Fasta Format > wh10d22
accctgctcctgcgatccccaaccgaccctgctcctgcgatccccaaccc caatccaagaccaagagcaacagggagaccatgagcgccatggtcgcgtc gtcgcttaacccggaggccccgctcttcatcccggcagcgttccagcagg tggaggacttctcaccgcagtggtgggacctcgtcaagtccaccgnctgg tttcgcgaccactggtaccaccagcaccagcagctcgacgatatggtcga ctccctcatggccttggaggccgaggacgccatcgccgtcgaggcttcgc agccgcagccgccagcggcactcaagattgacggggtgctcaaggcgctg agcctggcgtccccaagcccaaagggtggcttctcggagaagcctaggta caccgagaagcccaccaagtacgccggcagcccgaggagcggtggcgcac cg
Download
page-top