Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896586
Length 615 bp
Fasta Format > whthkles10b23
ccgcgaatcctcttgaaagagaggggtgccctcgggaacgcggacacagg tggtgcatggctgtcgtcagctcgtgccgtaaggtgttgggttaagtctc gcaacgagcgcaaccctcgtgtttagttgccactatgagtttggaaccct gaacagaccgccggtgttaagccggaggaaggagaggatgaggccaagtc atcatgccccttatgccctgggcgacacacgtgctacaatgggcgggaca aagggtcgcgatctcgcgagggtgagctaactccaaaaacccgtcctcag ttcggattgcaggctgcaactcgcctgcatgaagcaggaatcgctagtaa tcgccggtcagccatacggcggtgaatccgttcccgggccttgtacacac cgcccgtcacactataggagctggccatgtttgaagtcattacccttaac ccctcgtgccgaattcggcncgaggcttgcggtggatacctaggcaccca gagacgaggaagggcgtagcaagcgacgaaatgcttcggggagttgaaaa taagcatagatccggagattcccaaataggtcaaccttttaaactgcctg ctgaatccatgagca
Download
page-top