Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896585
Length 702 bp
Fasta Format > whthkles10b21
gattcgggaggacttccgccgtccgggaggcgaagagagggcgagatggg ggcgtccgaatctgtgctggagacctccgtacacgaattcaccgttaagg attgcaacggcaaggaggtgtgcctggacacgtacaaggggaaggtcctc ctcatcgtcaacgtcgcctccaaatgcgggttcacggagactaattacac gcagctgacggagctttatcagaagtacagggagaaagactttgagatat tagcattcccctgcaaccagttcttgcgacaagagccaggcagtgaccag cagatccaagactttgcatgcacaagattcaaagctgaatatccagtttt tcagaaggtgcgtgtaaatggcccagatgctgcgccgctttacaagtttc tgaaagctaacaaacctggtttgtttggttcaagaatcaagtggaacttt accaagtttcttgttgacaagaatggaaaagtaatcaacagatacgcaac tgctaccacaccattttcattcgagaaagacatccagaaggcacttgagg aggaaccctctgactcgcagacaaaaaaagaggaggaatcctccgactcg cagaagtaggcacttgcaaagtatccccgttgtaatatctagaccaatct ctgccagtaaattaatgtgatatttcccctggtttgatctttgttcttgt at
Download
page-top