Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896570
Length 404 bp
Fasta Format > whthkles10o09
tactggttcaccggaaagctcggcgcaaaaaggaggcagcgcctcccgcc ttcgccgcaggcgctgnccatcatagggcacctccacctcatcggttccc tcccccacgtcnccctccgcagcctcgcaaggaagcacggncccgacatg atgctcctccgactgggcgccgtgccgaccctcgtcgtgtcttcgccgcg cgctgcanaggcggtgctgcgcactcacnaccacgtcttcncttcacggc cccactccgtcgtctccgacaccatcatgtatggctcggctganatcggc ttcgcgccatacggtgagtactggcggcaagcaaggaagctcgtcaccac acacatgctgancgttaagaaggtgcagtctttccgcggcgtcnctgtgg agga
Download
page-top