Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896567
Length 723 bp
Fasta Format > whthkles10o01
taccccccacacctccgcagctttcctcccctttatccatctcccccgcc actcagctcctccaccggcgtggcgccgacgctaagaaccgatctgccga ttcagaggcaccgccgacggcggtgtggcagatcgaattggggcaagccg atccggcagagcatataggtaagaaatcgacagaactcgtcaaacccgta cccgatcggaaacatccatctcgatactgatttatattcatctcatattc cccaattctttgctgagctatgctaaaaaaacgggggcggaggacgcggc cacctgggtggcgtcaacggcgagcgtccgacaggccggcggtctcattc agttttctgtcgccctgctctagatgaaggtgttgtgttagctgatggca cggagctcgtacctgcaactattgagagagcatgttaggtacaggaatat tgaaaggtgactggcgaggtatcgtacatcccatgggacaaaataaattt accttctggtgtcatcgctccactgaaatcatccatcaggacgggatcag cattatctattccgaggtcgtatgagggaacctctgtgttaagcgctgca ttagggccatatacccattgcttacgatctgctgatttggcctggattgg catttgttcatgcaccatagtgtcattggttacttcattgtcttggtatg ctgccgcaaccagtcctnccaga
Download
page-top