Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896565
Length 705 bp
Fasta Format > whthkles10m21
acgatcttgacgctggtgcgggtcggatgggcgggaccacacagtacacc gtcaacaaccagatggtgaacgccaccctcatgaacatcgccgatgcccc caccaacgtgcagctcccaggcatgtacaacaaggaggagaaccctcgtg tgcccatcgtcgtcactggtaacgatttctcgacgttgtacgcccctctg atccgtgatggccgtatggagaagttctactgggctcccacccgcgacga ccgtatcggtgtctgcaagggtatcttccagaccgacaatgtcagcgacg agtccgtcgtcaagatcgtcgacaccttcccaggacaatccatcgacttt ttcggtgctctgcgtgctcgggtgtacgacgacgaggtgcgcaagtgggt gacctctaccggtatcgagaacattggcaagaggctggtgaactcgcggg acggacccgtgacctttgagcagccaaagatgacagtggagaagctgcta gagtacgggcacatgcttgtccaggagcaggacaatgtcaagcgtgtgca gcttgctgacacctacatgagccaggcagctctgggtgatgctaaccagg atgcgatgaagactggttccttctacggttagaacattctccatacacac ccaccatctcttgctgcataggaggaggtaaaggggcacagcaaggtact ttgcc
Download
page-top