Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896563
Length 511 bp
Fasta Format > whthkles10m17
cgtgagggtggacacctgcttgctcaccaacaccaccaacggcgtccgga tcaagagctggcaggggggcatgggctccgcccgcgacctgaggttcgag agcatcgtgatgaagaacgtgtccaatcccatcatcatcgaccagtacta ctgcgaccagcctacgccctgcgcgaaccagacggaggccgtggaggtgc gcaaggtggagttcgtggacgtgaggggcacgtcggcgacggcgcaggcg atcaagatcgcgtgcagcgacaccttgccgtgccgggagctggagctgag gaacgtcaacctcaccatggtgggcgggggcgcggccacggcctcctgct acagggcgtccggcaaggccgttggagccgtcgccccggcgtcctgcctc gccaagggtgacccgtgatggtcgttgaatgatgtttccaccgtctgttt gcgtacttggccggtgttttcaacatatagcttggtaaatatttatacaa taaaaaaaaaa
Download
page-top