Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896561
Length 710 bp
Fasta Format > whthkles10m13
cctacatagtacagccatggcccccaccgctgcatggcctcgtcggccac ctccgatcgctcctttccaggggctcaagtccaccgccggcctccccgtc agccgccgctccaacggcgctagcctcggcagcgtcagcaacggtggaag gatcaggtgcatgcaggtgtggcccatcgagggcattaagaagttcgaga ccctgtcctacctgccaccgctcagcacggaggccctcctcaagcaggtc gactacctgatccgctccaagtgggtgccttgcctcgagttcagcaaggt tgggtttatcttccgtgagcacaacgcatcccctgggtactacgatggcc ggtactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacg caggtgatcaacgaggtggaggaggtcaagaaggagtaccctgacgcgta tgtccgcatcatcggattcgacaacatgcgccaggtgcagtgcgtcagct tcatcgccttcaagccaccgggctgcgaggagtccggcaaggcctaaaca gctcactcaccacgggccacatataaagtgccattgcggttttgtcaact ctgacattgctttgggttttccttttccatttatctttcttgtttgttcc taagataagaatatgtgtatgtccatgttcccgacatgactcgagaaagc atgctcgtat
Download
page-top