Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896559
Length 709 bp
Fasta Format > whthkles10m09
ggatcctttacacgtaagacctattgctcatgcgatttgggatcctcatt ttggtcaacccgctgtggaagcctttactcgaggaggtgctgctggtcca gtgaatattgcttattctggagtttatcagtggtggtatacaataggatt acgcaccaatgaggatctttatactggagctctttttctattatttcttt ctacgctgtccttaatagcgggttggttacatctacaacccaaatggaaa ccaagcctttcgtggttcaaaaacgcggaatctcgtctcaatcatcattt gtcaggacttttcggggtaagttctttggcttggacaggacatttagttc atgttgctattcccgcatccaggggggagtacgttcgatggaataatttc ttagatgtattaccctatccccaggggttgggaccccttttgacgggtca atggaatctttatgcccaaaaccctgattcgagtaatcatttatttggta ccgctcaaggagccggaactgccattctaactcttcttgggggattccat ccacaaacacaaagtttgtggctgaccgatatggctcaccatcatttagc tattgcatttatttttctcattgccggtcacatgtatcgaactaacttcg gaattgggcacagtattaaagatcttttagaagcgcatactcctccgggg ggtcgatta
Download
page-top