Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896552
Length 665 bp
Fasta Format > whthkles10k19
cgtcgagatccgttaacaggcgccccccctccggctccggcgacagagag ggaggccaccgacggcggccggcgaccgaagatgttccttgtggactggt tctacggggtgctcgcgtcgctcggactctggcagaaggaggccaagatc ctcttcctcggcctcgacaacgccggcaagaccacgctcctccacatgct caaggacgagaggttggttcagcatcagcctacacagtatccaacttctg aagagctgagcatcgggaagatcaagttcaaggcatttgatttaggaggc catcagattgctcgccgtgtgtggaaggattactatgccaaggttgatgc agtggtgtacctcgtggacgcctatgacaaagagaggtttgccgaatcca agaaggagctcgacgccctcctctcagacgattcgctggccaccgtcccc ttcctgatcctgggcaacaagatcgacatcccctatgccgcctcagagga agagctccgctaccacctgggtcttagcaacttcacgactggcaagggca aggtgagcctcagcgagtccaatgtccgccccctggaggtcttcatgtgc agcatcgtccgcaagatgggctatggcgaagggttcaagtggatgtcgca gtatatcaagtaggt
Download
page-top