Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896551
Length 718 bp
Fasta Format > whthkles10k17
acaccaagccaacccaaaaccagtttcgtactagaagagtgaagcgaagc gatgaanaagaccgtggtcctgtaccctggcctcggcgtcggccacctgg tgccgatggtggaggtcgccaagctgttcctcaagcacggcctcgccgtc accatggcgctcgtcgagccgcaggtcaagtccactgacttctncgccgc ggtcgcccgcgcgagggcctccaacccctccgtcgccttccgcgtcctgc cgtcgccgcccgcagattccaaccccgacggcgcgcccaggcaccacgtc ntgaaggttatccaatcgctcgccgccatgaatgcgctcctccgcgactt cctccgctcgntgccctccgtccacgcgctcgtcctcgacatgttctgcn tcgacgcccaggacgtggcagccgagctcaagctgccggtcttctactca ttcgcctccgctgccagcgaccttgccatcttcctcaacctgccgagcaa gttcgccagcaatacggccaagataaaagagctcggcgactccatcatca ccttcccgggcgttcctcctttcaaggcttcggagctgccctccgaagtt atcggcgacgatgaagcactcgtgtacgtcttacncatgtttgagcgaat ggcagaggcgaaaggaattcttatcaattccttcgactcgctggaaaagc ccgcactgagcgctctca
Download
page-top