Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896550
Length 718 bp
Fasta Format > whthkles10k15
accatttcgtactagaagagtgaagcgaagcgatgaagaagaccgtggtc ctgtaccctggcctcggcgtcggccacctggtgccgatggtggaggtcgc caagctgttcctcaagcacggcctcgccgtcaccatggcgctcgtcgagc cgcaggtcaagtccactgacttctccgccgcggtcgcccgcgcgagggcc tccaacccctccgtcgccttccgcgtcctgccgtcgccgcccgcagattc caaccccgacggcgcgcccaggcaccacgtcgtgaaggttatccaatcgc tcgccgccatgaatgcgctcctccgcgacttcctccgctcgctgccctcc gtccacgcgctcgtcctcgacatgttctgcgtcgacgcccaggacgtggc agccgagctcaagctgccggtcttctactcattcgcctccgctgccagcg accttgccatcttcctcaacctgccgagcaagttcgccagcaatacggcc aagataaaagagctcggcgactccatcatcaccttcccgggcgttcctcc tttcaaggcttcggagctgccctccgaagttatcggcgacgatgaagcac tcgtgtacgtcttacgcatgtttgagcgaatggcagaggcgaaaggaatt cttatcaattccttcgactcgctggaaaagcccgcactgagcgctctcaa cgacggactttgcgttcc
Download
page-top