Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896549
Length 496 bp
Fasta Format > whthkles10k13
cacacaggaagctcctagccaacaccaatcaaagcctccatccaatccca agcaacctcgaggatgtcttgctgcggaggaaactgcggctgcggcagcg cctgcaagtgcggcaacggctgcggcggctgcaacatgtacccggaggtt gaggccgccggcgccaccctcctcgtctccgccaccgccacccacaaggc gagctcgggcgggatggagatggcggcggagaacggcggctgcggctgca cccagtgcaagtgcggcaccagctgcggctgctcctgctgcagctgctag atctatcatcggtcatgcatgcaccgcgcgcatcatatctatgatctatc tacaatctacttaccatgtaacgccacctgatcgagggtctttgtatgta tgtaagcacctgccagcatgagcagagcaggtgcactgccatgcatgtaa accgacccctaaataaaatctcccgtggtttaacctaaaaaaaaaa
Download
page-top