Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896547
Length 719 bp
Fasta Format > whthkles10k07
tggggaggcaagggtcaaggaaaatccttccagttgtgagcttgtcttcg ccaagatgggcatcaacccaatcatgatgagtgccggagagctggagagt ggcaacgccggagagccagccaagctcatcaggcagcggtaccgtgaggc tgcagacatgatcaagaagggtaagatgtgctgcctcttcatcaacgatc ttgacgccggtgcgggtaggatgggcgggaccacacagtacaccgtcaac aaccagatggtgaacgccaccctcatgaacatcgccgatgcccccaccaa tgtgcagctcccaggcatgtacaacaaggaggagaacccacgtgtgccca tcgtcgtcactggtaacgatttctcgacgttgtacgcccctctgatccgt gatggtcgtatggagaagttctactgggctcccacccgcgacgaccgtat cggtgtctgcaagggtatcttccagaccgacaatgtcagcgacgagtccg tcgtcaagatcgtcgacaccttcccaggacaatccatcgactttttcggt gctctgcgtgctcgggtgtacgacgacgaggtgcgcaagtgggtgacctc taccggtatcgagaacattggcaagaagctggtgaactcgcgggacggac cagtgacctttgagcagccaaagatgacagtggagaagctgctagagtac gggcacatgctcgtccagg
Download
page-top