Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896543
Length 652 bp
Fasta Format > whthkles10i23
gttcgagaccaccaagtactactgcaccgtcattgatgcccctggttcac cgtgacttcatcaagaacatgattactggtacctcccaggctgactgtgc tgtgctcatcattgactccaccactggtggttttgaggctggtatctcca aggatggccagacccgtgagcacgccctccttgctttcactcttggagtg aagcagatgatctgctgctgcaacaagatggatgccaccacccccaagta ctcgaaggcccgttatgaggaaattgtcaaggaagtctcttcctacctga agaaggtcggatacaaccctgacaaggttccctttgtccccatctctggg tttgagggtgacaacatgattgagaggtccaccaaccttgactggtacaa gggccctacccttcttgaggctcttgaccagatcaacgagcccaagaggc cctcagacaagcccctccgtcttccccttcaggacgtttacaagattggt ggcattggaactgtgcctgttggccgtgttgagactggtgtcatcaagcc tggtatggttgttacctttggtcccactggtctgacaactgaggtcaagt ctgttgagatgcaccacgagtctctcctggaggcgcttcctggtgacaac gt
Download
page-top