Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896542
Length 708 bp
Fasta Format > whthkles10i21
tcccaccctctctccgtgagctagcccaccaccacaaggtccacaactac agctaactcggtcgagatggctcgcactgcagctactaagctcgtgctgg tcgccctggtggcggcaatgatcctcgcagcctccgacgcggccatcagc tgcggccaggtgagctctgccttgaccccctgcgtcgcctatgcgaaggg cagcgggaccagcccgtctggggcctgctgcagcggcgtcaggaaattgg ccggcttagcgcggagcaccgccgacaagcaagctacatgcaggtgcctc aagagtgttgccggagggctcaaccccaacaaggccgcaggcattccctc caagtgcggcgtcagcgtcccctacacgatcagcgcatccgtggactgct ctaagatccactgatcgatttctggccgccatcatcgccgattatagttc cagcgattgatgctgagtacgttgaggtctcacacacacatatatacata tacatgaataaatgctctgatatgatctccatgtgagagataggagtacg tacatcgagccagctttgcatagctggccactgttgtatctattttgtat cagcgtttgattgttcgttcactccctttgagcagacacgggagtttgtt gtactttgtacgatgtacgcttatcatatatggattataaattaatctaa aaaaaaaa
Download
page-top