Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896538
Length 783 bp
Fasta Format > whthkles10i13
taacgaggagctcttgcatgtgcctcctcctcgtcctcctgtgatattat tctcatggccgtccagccccccaacccggcttctcctgttcccctcgtcc gggcagccaacctcggcggctggctcgtcacagagggctggatcctgccc tccctcttcgacggcatccccaacaatgatctgcaggatgacacgcagct gcagttcaggtccgtcacgcagaatgcgttcatagccgtcgagaatggcg gcggggcggcactggtcgccaaccgggcctcggcctccggctgggagtcc ttcaagctcgggcgaatcgacacaaatacgttcaacttcaaggtgttcaa tgaccaattcgttaccatcgccggtgttaacgcggtggccacaaccgcca tggccgggaagacagagacgttccagctagtgcgcaacgacgttgacaaa aataggatgaggatcagagcaccgaatggatccttcttgcaggcaaataa agatggttcggtgacggcaaactttggcgagagcacgacctggggagacg atgacccgtccgtgtttgtagtgaccatagtcaattgggtgccctccatc ttcgatggcatccccaacaaagatctcctggatggcacacaactgcagtt caagtccgtgacgcagaatgcgttcgtggctgccgagaatggcggcggcg cancgttggtcgccaaccgtccctcggctttcggctgggaaacttcaagc tctggcggatcgacaaaacaccttcacttcang
Download
page-top