Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896537
Length 280 bp
Fasta Format > whthkles10i11
gagctatccgggaagaagattatgcccgtgctgccaaaatcagggatgat ctgcgcatcctccatgaggatactgaagcttccntccttgcagcaaatac acnattctacnacgctttcaagaatgganattttactgcaatgtactcta tctgggctaaaggagaccatgtgtatgttgtccatcccggtgcaggtcgg atatccggttatgatgtggtcttgcaaagctgggaaatggtgtgcaacgc ggactatgagttccctctaaacattgatct
Download
page-top