Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896536
Length 673 bp
Fasta Format > whthkles10i09
gcacagccgcgcatccaccgttgctagcaaggtcgaccaagcagcaccga gatggctgctgccttctcctccaccgtcggtgccccggcttctacgccga ccaacttccttgggaagaagctcaagaagcaggtgacctcggccgtgaac taccatggcaagagctccaaggccaacaggttcacagtcatggcagcgga aaacctcgacgagaagaggaacacggacaagtggaagggtcttgcgtacg atatctccgacgaccagcaggacatcaccagagggaagggcatcgtggac tcgctcttccaggcgcccacgggcgacggcacccacgaggccgtcctcag ctcctacgagtacgtcagccagggactcaagaagtacgacttcgacaaca ccatgggaggcttctacatcgctcctgctttcatggacaagcttgttgtc catctctccaagaacttcatgaccctgcccaacatcaagatcccactcat cttgggtatctggggaggcaagggtcaaggaaaatcattccagtgcgagc ttgtcttcgccaagatgggcatcaacccaatcatgatgagtgccggagag ctggagagtggcaacgccggagagccagccaagctcatcaggcagcggta ccgtgaggctgcagacatgatca
Download
page-top