Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896531
Length 355 bp
Fasta Format > whthkles10g23
gtcggctatagacttctactggtacagttgacaaagttaaaggggctgat ggaaaagaccgtgtggtgctcacatttgatgggaagtatctgcctcacac tgaacagaaagccgcgaatatgatgtcgaagttgccctgcaaggcacctt gagataatgagatggctggtactaggagaagggggatatgtagcttcact aatgtctgcttatacttcagacaaaaaaattgagtgtcccttttctagtc tgaatgatcgaccaaataaagagttgtcatatagtatgtaatgtctgctt gtattttggacctggaacagcattcgacatgattttcctcgtctgaaaaa aaaaa
Download
page-top